Review



recombinant proteins rs 504393 tocris  (Tocris)


Bioz Verified Symbol Tocris is a verified supplier
Bioz Manufacturer Symbol Tocris manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Tocris recombinant proteins rs 504393 tocris
    Recombinant Proteins Rs 504393 Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 95/100, based on 128 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+proteins+rs+504393+tocris/RS+504393/pm33667385-219-165-169
    Average 95 stars, based on 128 article reviews
    recombinant proteins rs 504393 tocris - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Data-independent acquisition:

    Article Title: Type I collagen deletion in αSMA + myofibroblasts augments immune suppression and accelerates progression of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat Albumin Bethyl Cat# A90-134, RRID:AB_67120 Mouse aSMA DAKO Cat# M0851, RRID:AB_2223500 Rabbit CD206 (MRC1) Abcam Cat# ab64693, RRID:AB_1523910 Rabbit CD45R Abcam Cat# ab64100, RRID:AB_1140036 Rabbit CK19 Abcam Cat# ab52625, RRID:AB_2281020 Goat Collagen I SouthernBiotech Cat# 1310-01, RRID:AB_2753206 Rabbit Ki67 Abcam Cat# ab15580, RRID:AB_443209 Rabbit SOX9 Abcam Cat# ab185966, RRID:AB_2728660 Rabbit NG2 Chemicon/Millipore Cat# AB5320, RRID:AB_11213678 Rat CD31 Dianova Cat# DIA-310, RRID:AB_2631039 Goat Collagen IV Abcam Cat# ab6585, RRID:AB_305583 Rabbit FSP1 DAKO Cat# A5114, RRID:AB_2335679 Rabbit CD3 Abcam Cat# ab16669, RRID:AB_443425 Rabbit CD4 Cell Signaling Cat# 25229, RRID:AB_2798898 Rabbit CD8a Cell Signaling Cat# 98941, RRID:AB_2756376 Rat Cytokeratin 8 DSHB Cat# TROMA-I, RRID:AB_531826 Rat PDGFRa(CD140a)-PE BioLegend Cat# 135905, RRID:AB_1953268 Rat EpCAM(CD326)-AF488 BioLegend Cat# 118210, RRID:AB_1134099 Rat CD45-Pacific Blue BioLegend Cat# 103126, RRID:AB_493535 Rat CD3-AF700 eBioscience Cat# 56-0032-82, RRID:AB_529507 Rat CD11b-BV711 BD Cat# 563168, RRID:AB_2716860 Rat CD206-FITC BioLegend Cat# 141703, RRID:AB_10900988 Rat CD19-APC eBioscience Cat# 17-0193-82, RRID:AB_1659676 Biological Samples Tissue microarray sections of human PDAC MDACC IRB LAB05-0854 Chemicals, Peptides, and Recombinant Proteins RS 504393 Tocris Cat# 2517/10 SB 225002 Tocris Cat# 2725/10 Collagenase IV Gibco Cat# 17104019 Dispase II Gibco Cat# 17105041 Liberase Roche Cat# 5401020001 DNase I Roche Cat# 10104159001 Type I collagen solution from rat tail Sigma-Aldrich Cat# C3867 Critical Commercial Assays Direct-zol RNA Kit Zymo Research Cat# R2050 Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green Master Mix Applied Biosystems Cat# 4367659 Cell Counting Kit-8 Abcam Cat# ab228554 Live-Dead-eFluor780 eBioscience Cat# 65-0865-14 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Gomori’s Trichrome Stain Kit Leica Biosystems Cat# 38016SS2 Chromium Single Cell 3’ Reagent Kits (v2) 10x Genomics Cat# PN-120237 ABC-Kit Vector Cat# PK-6100 (Continued on next page) e1 Cancer Cell 39, 548–565.e1–e6, April 12, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Stable DAB Invitrogen Cat# 750118 Direct Red 80 Sigma-Aldrich Cat# 365548 TruSeq Stranded mRNA Sample Prep Kit Illumina Cat# 20020594 Deposited Data KPPF and KPPF;Col1smaKO tumor RNA-sequencing This paper GEO: GSE131500 Single-cell RNA-sequencing This paper GEO: GSE166298 TCGA pancreatic adenocarcinoma cohort survival and gene expression data (GDAC Firehose PAAD) Broad Institute http://gdac.broadinstitute.org/runs/ stddata__2016_01_28/data/PAAD/ 20160128/ Experimental Models: Cell Lines Primary mouse KPPF;Col1smaKO cancer cells This paper N/A Experimental Models: Organisms/Strains Mouse: FSF-KrasG12D/+;Pdx1-Flp Schonhuber et al., 2014 N/A Mouse: Trp53frt/+ Lee et al., 2012 N/A Mouse: aSMA-Cre LeBleu et al., 2013 N/A Mouse: Fsp1-Cre Xue et al., 2003; Bhowmick et al., 2004 N/A Mouse: Rosa26-CAG-loxP-frt-Stop-frtFireflyLuc-EGFP-loxP-RenillaLuctdTomato Chen et al., 2018 N/A Mouse: Col1a1tm1a(EUCOMM)Wtsi EuMMCR https://www.mousephenotype.org/data/ alleles/MGI:88467/tm1a(EUCOMM)Wtsii Mouse: Col1a1loxP/loxP This study N/A Oligonucleotides Mouse Gapdh qRT-PCR F AGGTCGGTGTGAACGGATTTG This paper N/A Mouse Gapdh qRT-PCR R TGTAGACCATGTAGTTGAGGTCA This paper N/A Mouse Col1a1 qRT-PCR F GCTCCTCTTAGGGGCCACT This paper N/A Mouse Col1a1 qRT-PCR R CCACGTCTCACCATTGGGG This paper N/A Mouse Cxcl5 qRT-PCR F GTTCCATCTCGCCATTCATGC This paper N/A Mouse Cxcl5 qRT-PCR R GCGGCTATGACTGAGGAAGG This paper N/A Mouse Sox9 qRT-PCR F GAGCCGGATCTGAAGAGGGA This paper N/A Mouse Sox9 qRT-PCR R GCTTGACGTGTGGCTTGTTC This paper N/A Software and Algorithms Flowjo v10.7.1 Flowjo, L.L.C.

    Microarray:

    Article Title: Type I collagen deletion in αSMA + myofibroblasts augments immune suppression and accelerates progression of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat Albumin Bethyl Cat# A90-134, RRID:AB_67120 Mouse aSMA DAKO Cat# M0851, RRID:AB_2223500 Rabbit CD206 (MRC1) Abcam Cat# ab64693, RRID:AB_1523910 Rabbit CD45R Abcam Cat# ab64100, RRID:AB_1140036 Rabbit CK19 Abcam Cat# ab52625, RRID:AB_2281020 Goat Collagen I SouthernBiotech Cat# 1310-01, RRID:AB_2753206 Rabbit Ki67 Abcam Cat# ab15580, RRID:AB_443209 Rabbit SOX9 Abcam Cat# ab185966, RRID:AB_2728660 Rabbit NG2 Chemicon/Millipore Cat# AB5320, RRID:AB_11213678 Rat CD31 Dianova Cat# DIA-310, RRID:AB_2631039 Goat Collagen IV Abcam Cat# ab6585, RRID:AB_305583 Rabbit FSP1 DAKO Cat# A5114, RRID:AB_2335679 Rabbit CD3 Abcam Cat# ab16669, RRID:AB_443425 Rabbit CD4 Cell Signaling Cat# 25229, RRID:AB_2798898 Rabbit CD8a Cell Signaling Cat# 98941, RRID:AB_2756376 Rat Cytokeratin 8 DSHB Cat# TROMA-I, RRID:AB_531826 Rat PDGFRa(CD140a)-PE BioLegend Cat# 135905, RRID:AB_1953268 Rat EpCAM(CD326)-AF488 BioLegend Cat# 118210, RRID:AB_1134099 Rat CD45-Pacific Blue BioLegend Cat# 103126, RRID:AB_493535 Rat CD3-AF700 eBioscience Cat# 56-0032-82, RRID:AB_529507 Rat CD11b-BV711 BD Cat# 563168, RRID:AB_2716860 Rat CD206-FITC BioLegend Cat# 141703, RRID:AB_10900988 Rat CD19-APC eBioscience Cat# 17-0193-82, RRID:AB_1659676 Biological Samples Tissue microarray sections of human PDAC MDACC IRB LAB05-0854 Chemicals, Peptides, and Recombinant Proteins RS 504393 Tocris Cat# 2517/10 SB 225002 Tocris Cat# 2725/10 Collagenase IV Gibco Cat# 17104019 Dispase II Gibco Cat# 17105041 Liberase Roche Cat# 5401020001 DNase I Roche Cat# 10104159001 Type I collagen solution from rat tail Sigma-Aldrich Cat# C3867 Critical Commercial Assays Direct-zol RNA Kit Zymo Research Cat# R2050 Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green Master Mix Applied Biosystems Cat# 4367659 Cell Counting Kit-8 Abcam Cat# ab228554 Live-Dead-eFluor780 eBioscience Cat# 65-0865-14 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Gomori’s Trichrome Stain Kit Leica Biosystems Cat# 38016SS2 Chromium Single Cell 3’ Reagent Kits (v2) 10x Genomics Cat# PN-120237 ABC-Kit Vector Cat# PK-6100 (Continued on next page) e1 Cancer Cell 39, 548–565.e1–e6, April 12, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Stable DAB Invitrogen Cat# 750118 Direct Red 80 Sigma-Aldrich Cat# 365548 TruSeq Stranded mRNA Sample Prep Kit Illumina Cat# 20020594 Deposited Data KPPF and KPPF;Col1smaKO tumor RNA-sequencing This paper GEO: GSE131500 Single-cell RNA-sequencing This paper GEO: GSE166298 TCGA pancreatic adenocarcinoma cohort survival and gene expression data (GDAC Firehose PAAD) Broad Institute http://gdac.broadinstitute.org/runs/ stddata__2016_01_28/data/PAAD/ 20160128/ Experimental Models: Cell Lines Primary mouse KPPF;Col1smaKO cancer cells This paper N/A Experimental Models: Organisms/Strains Mouse: FSF-KrasG12D/+;Pdx1-Flp Schonhuber et al., 2014 N/A Mouse: Trp53frt/+ Lee et al., 2012 N/A Mouse: aSMA-Cre LeBleu et al., 2013 N/A Mouse: Fsp1-Cre Xue et al., 2003; Bhowmick et al., 2004 N/A Mouse: Rosa26-CAG-loxP-frt-Stop-frtFireflyLuc-EGFP-loxP-RenillaLuctdTomato Chen et al., 2018 N/A Mouse: Col1a1tm1a(EUCOMM)Wtsi EuMMCR https://www.mousephenotype.org/data/ alleles/MGI:88467/tm1a(EUCOMM)Wtsii Mouse: Col1a1loxP/loxP This study N/A Oligonucleotides Mouse Gapdh qRT-PCR F AGGTCGGTGTGAACGGATTTG This paper N/A Mouse Gapdh qRT-PCR R TGTAGACCATGTAGTTGAGGTCA This paper N/A Mouse Col1a1 qRT-PCR F GCTCCTCTTAGGGGCCACT This paper N/A Mouse Col1a1 qRT-PCR R CCACGTCTCACCATTGGGG This paper N/A Mouse Cxcl5 qRT-PCR F GTTCCATCTCGCCATTCATGC This paper N/A Mouse Cxcl5 qRT-PCR R GCGGCTATGACTGAGGAAGG This paper N/A Mouse Sox9 qRT-PCR F GAGCCGGATCTGAAGAGGGA This paper N/A Mouse Sox9 qRT-PCR R GCTTGACGTGTGGCTTGTTC This paper N/A Software and Algorithms Flowjo v10.7.1 Flowjo, L.L.C.

    Recombinant:

    Article Title: Type I collagen deletion in αSMA + myofibroblasts augments immune suppression and accelerates progression of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat Albumin Bethyl Cat# A90-134, RRID:AB_67120 Mouse aSMA DAKO Cat# M0851, RRID:AB_2223500 Rabbit CD206 (MRC1) Abcam Cat# ab64693, RRID:AB_1523910 Rabbit CD45R Abcam Cat# ab64100, RRID:AB_1140036 Rabbit CK19 Abcam Cat# ab52625, RRID:AB_2281020 Goat Collagen I SouthernBiotech Cat# 1310-01, RRID:AB_2753206 Rabbit Ki67 Abcam Cat# ab15580, RRID:AB_443209 Rabbit SOX9 Abcam Cat# ab185966, RRID:AB_2728660 Rabbit NG2 Chemicon/Millipore Cat# AB5320, RRID:AB_11213678 Rat CD31 Dianova Cat# DIA-310, RRID:AB_2631039 Goat Collagen IV Abcam Cat# ab6585, RRID:AB_305583 Rabbit FSP1 DAKO Cat# A5114, RRID:AB_2335679 Rabbit CD3 Abcam Cat# ab16669, RRID:AB_443425 Rabbit CD4 Cell Signaling Cat# 25229, RRID:AB_2798898 Rabbit CD8a Cell Signaling Cat# 98941, RRID:AB_2756376 Rat Cytokeratin 8 DSHB Cat# TROMA-I, RRID:AB_531826 Rat PDGFRa(CD140a)-PE BioLegend Cat# 135905, RRID:AB_1953268 Rat EpCAM(CD326)-AF488 BioLegend Cat# 118210, RRID:AB_1134099 Rat CD45-Pacific Blue BioLegend Cat# 103126, RRID:AB_493535 Rat CD3-AF700 eBioscience Cat# 56-0032-82, RRID:AB_529507 Rat CD11b-BV711 BD Cat# 563168, RRID:AB_2716860 Rat CD206-FITC BioLegend Cat# 141703, RRID:AB_10900988 Rat CD19-APC eBioscience Cat# 17-0193-82, RRID:AB_1659676 Biological Samples Tissue microarray sections of human PDAC MDACC IRB LAB05-0854 Chemicals, Peptides, and Recombinant Proteins RS 504393 Tocris Cat# 2517/10 SB 225002 Tocris Cat# 2725/10 Collagenase IV Gibco Cat# 17104019 Dispase II Gibco Cat# 17105041 Liberase Roche Cat# 5401020001 DNase I Roche Cat# 10104159001 Type I collagen solution from rat tail Sigma-Aldrich Cat# C3867 Critical Commercial Assays Direct-zol RNA Kit Zymo Research Cat# R2050 Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green Master Mix Applied Biosystems Cat# 4367659 Cell Counting Kit-8 Abcam Cat# ab228554 Live-Dead-eFluor780 eBioscience Cat# 65-0865-14 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Gomori’s Trichrome Stain Kit Leica Biosystems Cat# 38016SS2 Chromium Single Cell 3’ Reagent Kits (v2) 10x Genomics Cat# PN-120237 ABC-Kit Vector Cat# PK-6100 (Continued on next page) e1 Cancer Cell 39, 548–565.e1–e6, April 12, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Stable DAB Invitrogen Cat# 750118 Direct Red 80 Sigma-Aldrich Cat# 365548 TruSeq Stranded mRNA Sample Prep Kit Illumina Cat# 20020594 Deposited Data KPPF and KPPF;Col1smaKO tumor RNA-sequencing This paper GEO: GSE131500 Single-cell RNA-sequencing This paper GEO: GSE166298 TCGA pancreatic adenocarcinoma cohort survival and gene expression data (GDAC Firehose PAAD) Broad Institute http://gdac.broadinstitute.org/runs/ stddata__2016_01_28/data/PAAD/ 20160128/ Experimental Models: Cell Lines Primary mouse KPPF;Col1smaKO cancer cells This paper N/A Experimental Models: Organisms/Strains Mouse: FSF-KrasG12D/+;Pdx1-Flp Schonhuber et al., 2014 N/A Mouse: Trp53frt/+ Lee et al., 2012 N/A Mouse: aSMA-Cre LeBleu et al., 2013 N/A Mouse: Fsp1-Cre Xue et al., 2003; Bhowmick et al., 2004 N/A Mouse: Rosa26-CAG-loxP-frt-Stop-frtFireflyLuc-EGFP-loxP-RenillaLuctdTomato Chen et al., 2018 N/A Mouse: Col1a1tm1a(EUCOMM)Wtsi EuMMCR https://www.mousephenotype.org/data/ alleles/MGI:88467/tm1a(EUCOMM)Wtsii Mouse: Col1a1loxP/loxP This study N/A Oligonucleotides Mouse Gapdh qRT-PCR F AGGTCGGTGTGAACGGATTTG This paper N/A Mouse Gapdh qRT-PCR R TGTAGACCATGTAGTTGAGGTCA This paper N/A Mouse Col1a1 qRT-PCR F GCTCCTCTTAGGGGCCACT This paper N/A Mouse Col1a1 qRT-PCR R CCACGTCTCACCATTGGGG This paper N/A Mouse Cxcl5 qRT-PCR F GTTCCATCTCGCCATTCATGC This paper N/A Mouse Cxcl5 qRT-PCR R GCGGCTATGACTGAGGAAGG This paper N/A Mouse Sox9 qRT-PCR F GAGCCGGATCTGAAGAGGGA This paper N/A Mouse Sox9 qRT-PCR R GCTTGACGTGTGGCTTGTTC This paper N/A Software and Algorithms Flowjo v10.7.1 Flowjo, L.L.C.

    Reverse Transcription:

    Article Title: Type I collagen deletion in αSMA + myofibroblasts augments immune suppression and accelerates progression of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat Albumin Bethyl Cat# A90-134, RRID:AB_67120 Mouse aSMA DAKO Cat# M0851, RRID:AB_2223500 Rabbit CD206 (MRC1) Abcam Cat# ab64693, RRID:AB_1523910 Rabbit CD45R Abcam Cat# ab64100, RRID:AB_1140036 Rabbit CK19 Abcam Cat# ab52625, RRID:AB_2281020 Goat Collagen I SouthernBiotech Cat# 1310-01, RRID:AB_2753206 Rabbit Ki67 Abcam Cat# ab15580, RRID:AB_443209 Rabbit SOX9 Abcam Cat# ab185966, RRID:AB_2728660 Rabbit NG2 Chemicon/Millipore Cat# AB5320, RRID:AB_11213678 Rat CD31 Dianova Cat# DIA-310, RRID:AB_2631039 Goat Collagen IV Abcam Cat# ab6585, RRID:AB_305583 Rabbit FSP1 DAKO Cat# A5114, RRID:AB_2335679 Rabbit CD3 Abcam Cat# ab16669, RRID:AB_443425 Rabbit CD4 Cell Signaling Cat# 25229, RRID:AB_2798898 Rabbit CD8a Cell Signaling Cat# 98941, RRID:AB_2756376 Rat Cytokeratin 8 DSHB Cat# TROMA-I, RRID:AB_531826 Rat PDGFRa(CD140a)-PE BioLegend Cat# 135905, RRID:AB_1953268 Rat EpCAM(CD326)-AF488 BioLegend Cat# 118210, RRID:AB_1134099 Rat CD45-Pacific Blue BioLegend Cat# 103126, RRID:AB_493535 Rat CD3-AF700 eBioscience Cat# 56-0032-82, RRID:AB_529507 Rat CD11b-BV711 BD Cat# 563168, RRID:AB_2716860 Rat CD206-FITC BioLegend Cat# 141703, RRID:AB_10900988 Rat CD19-APC eBioscience Cat# 17-0193-82, RRID:AB_1659676 Biological Samples Tissue microarray sections of human PDAC MDACC IRB LAB05-0854 Chemicals, Peptides, and Recombinant Proteins RS 504393 Tocris Cat# 2517/10 SB 225002 Tocris Cat# 2725/10 Collagenase IV Gibco Cat# 17104019 Dispase II Gibco Cat# 17105041 Liberase Roche Cat# 5401020001 DNase I Roche Cat# 10104159001 Type I collagen solution from rat tail Sigma-Aldrich Cat# C3867 Critical Commercial Assays Direct-zol RNA Kit Zymo Research Cat# R2050 Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green Master Mix Applied Biosystems Cat# 4367659 Cell Counting Kit-8 Abcam Cat# ab228554 Live-Dead-eFluor780 eBioscience Cat# 65-0865-14 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Gomori’s Trichrome Stain Kit Leica Biosystems Cat# 38016SS2 Chromium Single Cell 3’ Reagent Kits (v2) 10x Genomics Cat# PN-120237 ABC-Kit Vector Cat# PK-6100 (Continued on next page) e1 Cancer Cell 39, 548–565.e1–e6, April 12, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Stable DAB Invitrogen Cat# 750118 Direct Red 80 Sigma-Aldrich Cat# 365548 TruSeq Stranded mRNA Sample Prep Kit Illumina Cat# 20020594 Deposited Data KPPF and KPPF;Col1smaKO tumor RNA-sequencing This paper GEO: GSE131500 Single-cell RNA-sequencing This paper GEO: GSE166298 TCGA pancreatic adenocarcinoma cohort survival and gene expression data (GDAC Firehose PAAD) Broad Institute http://gdac.broadinstitute.org/runs/ stddata__2016_01_28/data/PAAD/ 20160128/ Experimental Models: Cell Lines Primary mouse KPPF;Col1smaKO cancer cells This paper N/A Experimental Models: Organisms/Strains Mouse: FSF-KrasG12D/+;Pdx1-Flp Schonhuber et al., 2014 N/A Mouse: Trp53frt/+ Lee et al., 2012 N/A Mouse: aSMA-Cre LeBleu et al., 2013 N/A Mouse: Fsp1-Cre Xue et al., 2003; Bhowmick et al., 2004 N/A Mouse: Rosa26-CAG-loxP-frt-Stop-frtFireflyLuc-EGFP-loxP-RenillaLuctdTomato Chen et al., 2018 N/A Mouse: Col1a1tm1a(EUCOMM)Wtsi EuMMCR https://www.mousephenotype.org/data/ alleles/MGI:88467/tm1a(EUCOMM)Wtsii Mouse: Col1a1loxP/loxP This study N/A Oligonucleotides Mouse Gapdh qRT-PCR F AGGTCGGTGTGAACGGATTTG This paper N/A Mouse Gapdh qRT-PCR R TGTAGACCATGTAGTTGAGGTCA This paper N/A Mouse Col1a1 qRT-PCR F GCTCCTCTTAGGGGCCACT This paper N/A Mouse Col1a1 qRT-PCR R CCACGTCTCACCATTGGGG This paper N/A Mouse Cxcl5 qRT-PCR F GTTCCATCTCGCCATTCATGC This paper N/A Mouse Cxcl5 qRT-PCR R GCGGCTATGACTGAGGAAGG This paper N/A Mouse Sox9 qRT-PCR F GAGCCGGATCTGAAGAGGGA This paper N/A Mouse Sox9 qRT-PCR R GCTTGACGTGTGGCTTGTTC This paper N/A Software and Algorithms Flowjo v10.7.1 Flowjo, L.L.C.

    SYBR Green Assay:

    Article Title: Type I collagen deletion in αSMA + myofibroblasts augments immune suppression and accelerates progression of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat Albumin Bethyl Cat# A90-134, RRID:AB_67120 Mouse aSMA DAKO Cat# M0851, RRID:AB_2223500 Rabbit CD206 (MRC1) Abcam Cat# ab64693, RRID:AB_1523910 Rabbit CD45R Abcam Cat# ab64100, RRID:AB_1140036 Rabbit CK19 Abcam Cat# ab52625, RRID:AB_2281020 Goat Collagen I SouthernBiotech Cat# 1310-01, RRID:AB_2753206 Rabbit Ki67 Abcam Cat# ab15580, RRID:AB_443209 Rabbit SOX9 Abcam Cat# ab185966, RRID:AB_2728660 Rabbit NG2 Chemicon/Millipore Cat# AB5320, RRID:AB_11213678 Rat CD31 Dianova Cat# DIA-310, RRID:AB_2631039 Goat Collagen IV Abcam Cat# ab6585, RRID:AB_305583 Rabbit FSP1 DAKO Cat# A5114, RRID:AB_2335679 Rabbit CD3 Abcam Cat# ab16669, RRID:AB_443425 Rabbit CD4 Cell Signaling Cat# 25229, RRID:AB_2798898 Rabbit CD8a Cell Signaling Cat# 98941, RRID:AB_2756376 Rat Cytokeratin 8 DSHB Cat# TROMA-I, RRID:AB_531826 Rat PDGFRa(CD140a)-PE BioLegend Cat# 135905, RRID:AB_1953268 Rat EpCAM(CD326)-AF488 BioLegend Cat# 118210, RRID:AB_1134099 Rat CD45-Pacific Blue BioLegend Cat# 103126, RRID:AB_493535 Rat CD3-AF700 eBioscience Cat# 56-0032-82, RRID:AB_529507 Rat CD11b-BV711 BD Cat# 563168, RRID:AB_2716860 Rat CD206-FITC BioLegend Cat# 141703, RRID:AB_10900988 Rat CD19-APC eBioscience Cat# 17-0193-82, RRID:AB_1659676 Biological Samples Tissue microarray sections of human PDAC MDACC IRB LAB05-0854 Chemicals, Peptides, and Recombinant Proteins RS 504393 Tocris Cat# 2517/10 SB 225002 Tocris Cat# 2725/10 Collagenase IV Gibco Cat# 17104019 Dispase II Gibco Cat# 17105041 Liberase Roche Cat# 5401020001 DNase I Roche Cat# 10104159001 Type I collagen solution from rat tail Sigma-Aldrich Cat# C3867 Critical Commercial Assays Direct-zol RNA Kit Zymo Research Cat# R2050 Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green Master Mix Applied Biosystems Cat# 4367659 Cell Counting Kit-8 Abcam Cat# ab228554 Live-Dead-eFluor780 eBioscience Cat# 65-0865-14 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Gomori’s Trichrome Stain Kit Leica Biosystems Cat# 38016SS2 Chromium Single Cell 3’ Reagent Kits (v2) 10x Genomics Cat# PN-120237 ABC-Kit Vector Cat# PK-6100 (Continued on next page) e1 Cancer Cell 39, 548–565.e1–e6, April 12, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Stable DAB Invitrogen Cat# 750118 Direct Red 80 Sigma-Aldrich Cat# 365548 TruSeq Stranded mRNA Sample Prep Kit Illumina Cat# 20020594 Deposited Data KPPF and KPPF;Col1smaKO tumor RNA-sequencing This paper GEO: GSE131500 Single-cell RNA-sequencing This paper GEO: GSE166298 TCGA pancreatic adenocarcinoma cohort survival and gene expression data (GDAC Firehose PAAD) Broad Institute http://gdac.broadinstitute.org/runs/ stddata__2016_01_28/data/PAAD/ 20160128/ Experimental Models: Cell Lines Primary mouse KPPF;Col1smaKO cancer cells This paper N/A Experimental Models: Organisms/Strains Mouse: FSF-KrasG12D/+;Pdx1-Flp Schonhuber et al., 2014 N/A Mouse: Trp53frt/+ Lee et al., 2012 N/A Mouse: aSMA-Cre LeBleu et al., 2013 N/A Mouse: Fsp1-Cre Xue et al., 2003; Bhowmick et al., 2004 N/A Mouse: Rosa26-CAG-loxP-frt-Stop-frtFireflyLuc-EGFP-loxP-RenillaLuctdTomato Chen et al., 2018 N/A Mouse: Col1a1tm1a(EUCOMM)Wtsi EuMMCR https://www.mousephenotype.org/data/ alleles/MGI:88467/tm1a(EUCOMM)Wtsii Mouse: Col1a1loxP/loxP This study N/A Oligonucleotides Mouse Gapdh qRT-PCR F AGGTCGGTGTGAACGGATTTG This paper N/A Mouse Gapdh qRT-PCR R TGTAGACCATGTAGTTGAGGTCA This paper N/A Mouse Col1a1 qRT-PCR F GCTCCTCTTAGGGGCCACT This paper N/A Mouse Col1a1 qRT-PCR R CCACGTCTCACCATTGGGG This paper N/A Mouse Cxcl5 qRT-PCR F GTTCCATCTCGCCATTCATGC This paper N/A Mouse Cxcl5 qRT-PCR R GCGGCTATGACTGAGGAAGG This paper N/A Mouse Sox9 qRT-PCR F GAGCCGGATCTGAAGAGGGA This paper N/A Mouse Sox9 qRT-PCR R GCTTGACGTGTGGCTTGTTC This paper N/A Software and Algorithms Flowjo v10.7.1 Flowjo, L.L.C.

    CCK-8 Assay:

    Article Title: Type I collagen deletion in αSMA + myofibroblasts augments immune suppression and accelerates progression of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat Albumin Bethyl Cat# A90-134, RRID:AB_67120 Mouse aSMA DAKO Cat# M0851, RRID:AB_2223500 Rabbit CD206 (MRC1) Abcam Cat# ab64693, RRID:AB_1523910 Rabbit CD45R Abcam Cat# ab64100, RRID:AB_1140036 Rabbit CK19 Abcam Cat# ab52625, RRID:AB_2281020 Goat Collagen I SouthernBiotech Cat# 1310-01, RRID:AB_2753206 Rabbit Ki67 Abcam Cat# ab15580, RRID:AB_443209 Rabbit SOX9 Abcam Cat# ab185966, RRID:AB_2728660 Rabbit NG2 Chemicon/Millipore Cat# AB5320, RRID:AB_11213678 Rat CD31 Dianova Cat# DIA-310, RRID:AB_2631039 Goat Collagen IV Abcam Cat# ab6585, RRID:AB_305583 Rabbit FSP1 DAKO Cat# A5114, RRID:AB_2335679 Rabbit CD3 Abcam Cat# ab16669, RRID:AB_443425 Rabbit CD4 Cell Signaling Cat# 25229, RRID:AB_2798898 Rabbit CD8a Cell Signaling Cat# 98941, RRID:AB_2756376 Rat Cytokeratin 8 DSHB Cat# TROMA-I, RRID:AB_531826 Rat PDGFRa(CD140a)-PE BioLegend Cat# 135905, RRID:AB_1953268 Rat EpCAM(CD326)-AF488 BioLegend Cat# 118210, RRID:AB_1134099 Rat CD45-Pacific Blue BioLegend Cat# 103126, RRID:AB_493535 Rat CD3-AF700 eBioscience Cat# 56-0032-82, RRID:AB_529507 Rat CD11b-BV711 BD Cat# 563168, RRID:AB_2716860 Rat CD206-FITC BioLegend Cat# 141703, RRID:AB_10900988 Rat CD19-APC eBioscience Cat# 17-0193-82, RRID:AB_1659676 Biological Samples Tissue microarray sections of human PDAC MDACC IRB LAB05-0854 Chemicals, Peptides, and Recombinant Proteins RS 504393 Tocris Cat# 2517/10 SB 225002 Tocris Cat# 2725/10 Collagenase IV Gibco Cat# 17104019 Dispase II Gibco Cat# 17105041 Liberase Roche Cat# 5401020001 DNase I Roche Cat# 10104159001 Type I collagen solution from rat tail Sigma-Aldrich Cat# C3867 Critical Commercial Assays Direct-zol RNA Kit Zymo Research Cat# R2050 Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green Master Mix Applied Biosystems Cat# 4367659 Cell Counting Kit-8 Abcam Cat# ab228554 Live-Dead-eFluor780 eBioscience Cat# 65-0865-14 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Gomori’s Trichrome Stain Kit Leica Biosystems Cat# 38016SS2 Chromium Single Cell 3’ Reagent Kits (v2) 10x Genomics Cat# PN-120237 ABC-Kit Vector Cat# PK-6100 (Continued on next page) e1 Cancer Cell 39, 548–565.e1–e6, April 12, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Stable DAB Invitrogen Cat# 750118 Direct Red 80 Sigma-Aldrich Cat# 365548 TruSeq Stranded mRNA Sample Prep Kit Illumina Cat# 20020594 Deposited Data KPPF and KPPF;Col1smaKO tumor RNA-sequencing This paper GEO: GSE131500 Single-cell RNA-sequencing This paper GEO: GSE166298 TCGA pancreatic adenocarcinoma cohort survival and gene expression data (GDAC Firehose PAAD) Broad Institute http://gdac.broadinstitute.org/runs/ stddata__2016_01_28/data/PAAD/ 20160128/ Experimental Models: Cell Lines Primary mouse KPPF;Col1smaKO cancer cells This paper N/A Experimental Models: Organisms/Strains Mouse: FSF-KrasG12D/+;Pdx1-Flp Schonhuber et al., 2014 N/A Mouse: Trp53frt/+ Lee et al., 2012 N/A Mouse: aSMA-Cre LeBleu et al., 2013 N/A Mouse: Fsp1-Cre Xue et al., 2003; Bhowmick et al., 2004 N/A Mouse: Rosa26-CAG-loxP-frt-Stop-frtFireflyLuc-EGFP-loxP-RenillaLuctdTomato Chen et al., 2018 N/A Mouse: Col1a1tm1a(EUCOMM)Wtsi EuMMCR https://www.mousephenotype.org/data/ alleles/MGI:88467/tm1a(EUCOMM)Wtsii Mouse: Col1a1loxP/loxP This study N/A Oligonucleotides Mouse Gapdh qRT-PCR F AGGTCGGTGTGAACGGATTTG This paper N/A Mouse Gapdh qRT-PCR R TGTAGACCATGTAGTTGAGGTCA This paper N/A Mouse Col1a1 qRT-PCR F GCTCCTCTTAGGGGCCACT This paper N/A Mouse Col1a1 qRT-PCR R CCACGTCTCACCATTGGGG This paper N/A Mouse Cxcl5 qRT-PCR F GTTCCATCTCGCCATTCATGC This paper N/A Mouse Cxcl5 qRT-PCR R GCGGCTATGACTGAGGAAGG This paper N/A Mouse Sox9 qRT-PCR F GAGCCGGATCTGAAGAGGGA This paper N/A Mouse Sox9 qRT-PCR R GCTTGACGTGTGGCTTGTTC This paper N/A Software and Algorithms Flowjo v10.7.1 Flowjo, L.L.C.

    Staining:

    Article Title: Type I collagen deletion in αSMA + myofibroblasts augments immune suppression and accelerates progression of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat Albumin Bethyl Cat# A90-134, RRID:AB_67120 Mouse aSMA DAKO Cat# M0851, RRID:AB_2223500 Rabbit CD206 (MRC1) Abcam Cat# ab64693, RRID:AB_1523910 Rabbit CD45R Abcam Cat# ab64100, RRID:AB_1140036 Rabbit CK19 Abcam Cat# ab52625, RRID:AB_2281020 Goat Collagen I SouthernBiotech Cat# 1310-01, RRID:AB_2753206 Rabbit Ki67 Abcam Cat# ab15580, RRID:AB_443209 Rabbit SOX9 Abcam Cat# ab185966, RRID:AB_2728660 Rabbit NG2 Chemicon/Millipore Cat# AB5320, RRID:AB_11213678 Rat CD31 Dianova Cat# DIA-310, RRID:AB_2631039 Goat Collagen IV Abcam Cat# ab6585, RRID:AB_305583 Rabbit FSP1 DAKO Cat# A5114, RRID:AB_2335679 Rabbit CD3 Abcam Cat# ab16669, RRID:AB_443425 Rabbit CD4 Cell Signaling Cat# 25229, RRID:AB_2798898 Rabbit CD8a Cell Signaling Cat# 98941, RRID:AB_2756376 Rat Cytokeratin 8 DSHB Cat# TROMA-I, RRID:AB_531826 Rat PDGFRa(CD140a)-PE BioLegend Cat# 135905, RRID:AB_1953268 Rat EpCAM(CD326)-AF488 BioLegend Cat# 118210, RRID:AB_1134099 Rat CD45-Pacific Blue BioLegend Cat# 103126, RRID:AB_493535 Rat CD3-AF700 eBioscience Cat# 56-0032-82, RRID:AB_529507 Rat CD11b-BV711 BD Cat# 563168, RRID:AB_2716860 Rat CD206-FITC BioLegend Cat# 141703, RRID:AB_10900988 Rat CD19-APC eBioscience Cat# 17-0193-82, RRID:AB_1659676 Biological Samples Tissue microarray sections of human PDAC MDACC IRB LAB05-0854 Chemicals, Peptides, and Recombinant Proteins RS 504393 Tocris Cat# 2517/10 SB 225002 Tocris Cat# 2725/10 Collagenase IV Gibco Cat# 17104019 Dispase II Gibco Cat# 17105041 Liberase Roche Cat# 5401020001 DNase I Roche Cat# 10104159001 Type I collagen solution from rat tail Sigma-Aldrich Cat# C3867 Critical Commercial Assays Direct-zol RNA Kit Zymo Research Cat# R2050 Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green Master Mix Applied Biosystems Cat# 4367659 Cell Counting Kit-8 Abcam Cat# ab228554 Live-Dead-eFluor780 eBioscience Cat# 65-0865-14 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Gomori’s Trichrome Stain Kit Leica Biosystems Cat# 38016SS2 Chromium Single Cell 3’ Reagent Kits (v2) 10x Genomics Cat# PN-120237 ABC-Kit Vector Cat# PK-6100 (Continued on next page) e1 Cancer Cell 39, 548–565.e1–e6, April 12, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Stable DAB Invitrogen Cat# 750118 Direct Red 80 Sigma-Aldrich Cat# 365548 TruSeq Stranded mRNA Sample Prep Kit Illumina Cat# 20020594 Deposited Data KPPF and KPPF;Col1smaKO tumor RNA-sequencing This paper GEO: GSE131500 Single-cell RNA-sequencing This paper GEO: GSE166298 TCGA pancreatic adenocarcinoma cohort survival and gene expression data (GDAC Firehose PAAD) Broad Institute http://gdac.broadinstitute.org/runs/ stddata__2016_01_28/data/PAAD/ 20160128/ Experimental Models: Cell Lines Primary mouse KPPF;Col1smaKO cancer cells This paper N/A Experimental Models: Organisms/Strains Mouse: FSF-KrasG12D/+;Pdx1-Flp Schonhuber et al., 2014 N/A Mouse: Trp53frt/+ Lee et al., 2012 N/A Mouse: aSMA-Cre LeBleu et al., 2013 N/A Mouse: Fsp1-Cre Xue et al., 2003; Bhowmick et al., 2004 N/A Mouse: Rosa26-CAG-loxP-frt-Stop-frtFireflyLuc-EGFP-loxP-RenillaLuctdTomato Chen et al., 2018 N/A Mouse: Col1a1tm1a(EUCOMM)Wtsi EuMMCR https://www.mousephenotype.org/data/ alleles/MGI:88467/tm1a(EUCOMM)Wtsii Mouse: Col1a1loxP/loxP This study N/A Oligonucleotides Mouse Gapdh qRT-PCR F AGGTCGGTGTGAACGGATTTG This paper N/A Mouse Gapdh qRT-PCR R TGTAGACCATGTAGTTGAGGTCA This paper N/A Mouse Col1a1 qRT-PCR F GCTCCTCTTAGGGGCCACT This paper N/A Mouse Col1a1 qRT-PCR R CCACGTCTCACCATTGGGG This paper N/A Mouse Cxcl5 qRT-PCR F GTTCCATCTCGCCATTCATGC This paper N/A Mouse Cxcl5 qRT-PCR R GCGGCTATGACTGAGGAAGG This paper N/A Mouse Sox9 qRT-PCR F GAGCCGGATCTGAAGAGGGA This paper N/A Mouse Sox9 qRT-PCR R GCTTGACGTGTGGCTTGTTC This paper N/A Software and Algorithms Flowjo v10.7.1 Flowjo, L.L.C.

    Single Cell:

    Article Title: Type I collagen deletion in αSMA + myofibroblasts augments immune suppression and accelerates progression of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat Albumin Bethyl Cat# A90-134, RRID:AB_67120 Mouse aSMA DAKO Cat# M0851, RRID:AB_2223500 Rabbit CD206 (MRC1) Abcam Cat# ab64693, RRID:AB_1523910 Rabbit CD45R Abcam Cat# ab64100, RRID:AB_1140036 Rabbit CK19 Abcam Cat# ab52625, RRID:AB_2281020 Goat Collagen I SouthernBiotech Cat# 1310-01, RRID:AB_2753206 Rabbit Ki67 Abcam Cat# ab15580, RRID:AB_443209 Rabbit SOX9 Abcam Cat# ab185966, RRID:AB_2728660 Rabbit NG2 Chemicon/Millipore Cat# AB5320, RRID:AB_11213678 Rat CD31 Dianova Cat# DIA-310, RRID:AB_2631039 Goat Collagen IV Abcam Cat# ab6585, RRID:AB_305583 Rabbit FSP1 DAKO Cat# A5114, RRID:AB_2335679 Rabbit CD3 Abcam Cat# ab16669, RRID:AB_443425 Rabbit CD4 Cell Signaling Cat# 25229, RRID:AB_2798898 Rabbit CD8a Cell Signaling Cat# 98941, RRID:AB_2756376 Rat Cytokeratin 8 DSHB Cat# TROMA-I, RRID:AB_531826 Rat PDGFRa(CD140a)-PE BioLegend Cat# 135905, RRID:AB_1953268 Rat EpCAM(CD326)-AF488 BioLegend Cat# 118210, RRID:AB_1134099 Rat CD45-Pacific Blue BioLegend Cat# 103126, RRID:AB_493535 Rat CD3-AF700 eBioscience Cat# 56-0032-82, RRID:AB_529507 Rat CD11b-BV711 BD Cat# 563168, RRID:AB_2716860 Rat CD206-FITC BioLegend Cat# 141703, RRID:AB_10900988 Rat CD19-APC eBioscience Cat# 17-0193-82, RRID:AB_1659676 Biological Samples Tissue microarray sections of human PDAC MDACC IRB LAB05-0854 Chemicals, Peptides, and Recombinant Proteins RS 504393 Tocris Cat# 2517/10 SB 225002 Tocris Cat# 2725/10 Collagenase IV Gibco Cat# 17104019 Dispase II Gibco Cat# 17105041 Liberase Roche Cat# 5401020001 DNase I Roche Cat# 10104159001 Type I collagen solution from rat tail Sigma-Aldrich Cat# C3867 Critical Commercial Assays Direct-zol RNA Kit Zymo Research Cat# R2050 Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green Master Mix Applied Biosystems Cat# 4367659 Cell Counting Kit-8 Abcam Cat# ab228554 Live-Dead-eFluor780 eBioscience Cat# 65-0865-14 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Gomori’s Trichrome Stain Kit Leica Biosystems Cat# 38016SS2 Chromium Single Cell 3’ Reagent Kits (v2) 10x Genomics Cat# PN-120237 ABC-Kit Vector Cat# PK-6100 (Continued on next page) e1 Cancer Cell 39, 548–565.e1–e6, April 12, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Stable DAB Invitrogen Cat# 750118 Direct Red 80 Sigma-Aldrich Cat# 365548 TruSeq Stranded mRNA Sample Prep Kit Illumina Cat# 20020594 Deposited Data KPPF and KPPF;Col1smaKO tumor RNA-sequencing This paper GEO: GSE131500 Single-cell RNA-sequencing This paper GEO: GSE166298 TCGA pancreatic adenocarcinoma cohort survival and gene expression data (GDAC Firehose PAAD) Broad Institute http://gdac.broadinstitute.org/runs/ stddata__2016_01_28/data/PAAD/ 20160128/ Experimental Models: Cell Lines Primary mouse KPPF;Col1smaKO cancer cells This paper N/A Experimental Models: Organisms/Strains Mouse: FSF-KrasG12D/+;Pdx1-Flp Schonhuber et al., 2014 N/A Mouse: Trp53frt/+ Lee et al., 2012 N/A Mouse: aSMA-Cre LeBleu et al., 2013 N/A Mouse: Fsp1-Cre Xue et al., 2003; Bhowmick et al., 2004 N/A Mouse: Rosa26-CAG-loxP-frt-Stop-frtFireflyLuc-EGFP-loxP-RenillaLuctdTomato Chen et al., 2018 N/A Mouse: Col1a1tm1a(EUCOMM)Wtsi EuMMCR https://www.mousephenotype.org/data/ alleles/MGI:88467/tm1a(EUCOMM)Wtsii Mouse: Col1a1loxP/loxP This study N/A Oligonucleotides Mouse Gapdh qRT-PCR F AGGTCGGTGTGAACGGATTTG This paper N/A Mouse Gapdh qRT-PCR R TGTAGACCATGTAGTTGAGGTCA This paper N/A Mouse Col1a1 qRT-PCR F GCTCCTCTTAGGGGCCACT This paper N/A Mouse Col1a1 qRT-PCR R CCACGTCTCACCATTGGGG This paper N/A Mouse Cxcl5 qRT-PCR F GTTCCATCTCGCCATTCATGC This paper N/A Mouse Cxcl5 qRT-PCR R GCGGCTATGACTGAGGAAGG This paper N/A Mouse Sox9 qRT-PCR F GAGCCGGATCTGAAGAGGGA This paper N/A Mouse Sox9 qRT-PCR R GCTTGACGTGTGGCTTGTTC This paper N/A Software and Algorithms Flowjo v10.7.1 Flowjo, L.L.C.



    Similar Products

    95
    MedChemExpress recombinant proteins ccr2 chemokine receptor anagonist rs504393 tocris
    Figure 6. CCL2 Promotes the Expression of POSTN in BM-MSCs via STAT3 Activation (A) qRT-PCR analysis of the levels of POSTN, c-JUN, RUNX1, RUNX2, STAT3, and YY1 in BM-MSCs and rmCCL2-treated BM-MSCs (n = 3 per group). (B) Western blot analysis of the levels of POSTN, phosphorylated STAT3 (p-STAT3), and STAT3 in BM-MSCs isolated from mice with or without B-ALL. (C) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without <t>RS504393.</t> (D) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without RS504393. (E) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and co-cultured BM-MSCs pre-incubated with or without RS504393. (F) Western blot analysis of the levels of p-STAT3 and STAT3 in mouse BM-MSCs co-cultured with L1210-GFP-Luc-sh-ctrl cells or L1210-GFP-Luc-sh-CCL2 cells. (G) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs transfected with siRNAs to knock down STAT3. (H and I) qRT-PCR assay of the mRNA levels of STAT3 (H) and POSTN (I) in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs (n = 3 per group). (J) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs. (K) Analysis of the effect of STAT3 knockdown in BM-MSCs on CCL2-promoted adhesion of L1210-GFP-Luc cells to mouse BM-MSCs (n = 6 per group). The graphs show mean ± SD. Significance is indicated as follows: **p < 0.01; ***p < 0.001; ns, no significance.
    Recombinant Proteins Ccr2 Chemokine Receptor Anagonist Rs504393 Tocris, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+proteins+rs+504393+tocris/RS+504393/pm30726736-178-226-244
    Average 95 stars, based on 1 article reviews
    recombinant proteins ccr2 chemokine receptor anagonist rs504393 tocris - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Tocris recombinant proteins rs 504393 tocris
    Figure 6. CCL2 Promotes the Expression of POSTN in BM-MSCs via STAT3 Activation (A) qRT-PCR analysis of the levels of POSTN, c-JUN, RUNX1, RUNX2, STAT3, and YY1 in BM-MSCs and rmCCL2-treated BM-MSCs (n = 3 per group). (B) Western blot analysis of the levels of POSTN, phosphorylated STAT3 (p-STAT3), and STAT3 in BM-MSCs isolated from mice with or without B-ALL. (C) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without <t>RS504393.</t> (D) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without RS504393. (E) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and co-cultured BM-MSCs pre-incubated with or without RS504393. (F) Western blot analysis of the levels of p-STAT3 and STAT3 in mouse BM-MSCs co-cultured with L1210-GFP-Luc-sh-ctrl cells or L1210-GFP-Luc-sh-CCL2 cells. (G) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs transfected with siRNAs to knock down STAT3. (H and I) qRT-PCR assay of the mRNA levels of STAT3 (H) and POSTN (I) in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs (n = 3 per group). (J) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs. (K) Analysis of the effect of STAT3 knockdown in BM-MSCs on CCL2-promoted adhesion of L1210-GFP-Luc cells to mouse BM-MSCs (n = 6 per group). The graphs show mean ± SD. Significance is indicated as follows: **p < 0.01; ***p < 0.001; ns, no significance.
    Recombinant Proteins Rs 504393 Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+proteins+rs+504393+tocris/RS+504393/pm33667385-219-165-169
    Average 95 stars, based on 1 article reviews
    recombinant proteins rs 504393 tocris - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    93
    Tocris recombinant proteins ccr2 chemokine receptor anagonist rs504393 tocris
    Figure 6. CCL2 Promotes the Expression of POSTN in BM-MSCs via STAT3 Activation (A) qRT-PCR analysis of the levels of POSTN, c-JUN, RUNX1, RUNX2, STAT3, and YY1 in BM-MSCs and rmCCL2-treated BM-MSCs (n = 3 per group). (B) Western blot analysis of the levels of POSTN, phosphorylated STAT3 (p-STAT3), and STAT3 in BM-MSCs isolated from mice with or without B-ALL. (C) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without <t>RS504393.</t> (D) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without RS504393. (E) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and co-cultured BM-MSCs pre-incubated with or without RS504393. (F) Western blot analysis of the levels of p-STAT3 and STAT3 in mouse BM-MSCs co-cultured with L1210-GFP-Luc-sh-ctrl cells or L1210-GFP-Luc-sh-CCL2 cells. (G) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs transfected with siRNAs to knock down STAT3. (H and I) qRT-PCR assay of the mRNA levels of STAT3 (H) and POSTN (I) in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs (n = 3 per group). (J) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs. (K) Analysis of the effect of STAT3 knockdown in BM-MSCs on CCL2-promoted adhesion of L1210-GFP-Luc cells to mouse BM-MSCs (n = 6 per group). The graphs show mean ± SD. Significance is indicated as follows: **p < 0.01; ***p < 0.001; ns, no significance.
    Recombinant Proteins Ccr2 Chemokine Receptor Anagonist Rs504393 Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+proteins+rs+504393+tocris/RS+504393/pm30726736-178-226-233
    Average 93 stars, based on 1 article reviews
    recombinant proteins ccr2 chemokine receptor anagonist rs504393 tocris - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Figure 6. CCL2 Promotes the Expression of POSTN in BM-MSCs via STAT3 Activation (A) qRT-PCR analysis of the levels of POSTN, c-JUN, RUNX1, RUNX2, STAT3, and YY1 in BM-MSCs and rmCCL2-treated BM-MSCs (n = 3 per group). (B) Western blot analysis of the levels of POSTN, phosphorylated STAT3 (p-STAT3), and STAT3 in BM-MSCs isolated from mice with or without B-ALL. (C) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without RS504393. (D) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without RS504393. (E) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and co-cultured BM-MSCs pre-incubated with or without RS504393. (F) Western blot analysis of the levels of p-STAT3 and STAT3 in mouse BM-MSCs co-cultured with L1210-GFP-Luc-sh-ctrl cells or L1210-GFP-Luc-sh-CCL2 cells. (G) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs transfected with siRNAs to knock down STAT3. (H and I) qRT-PCR assay of the mRNA levels of STAT3 (H) and POSTN (I) in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs (n = 3 per group). (J) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs. (K) Analysis of the effect of STAT3 knockdown in BM-MSCs on CCL2-promoted adhesion of L1210-GFP-Luc cells to mouse BM-MSCs (n = 6 per group). The graphs show mean ± SD. Significance is indicated as follows: **p < 0.01; ***p < 0.001; ns, no significance.

    Journal: Cell reports

    Article Title: Bone Marrow Mesenchymal Stromal Cell-Derived Periostin Promotes B-ALL Progression by Modulating CCL2 in Leukemia Cells.

    doi: 10.1016/j.celrep.2019.01.034

    Figure Lengend Snippet: Figure 6. CCL2 Promotes the Expression of POSTN in BM-MSCs via STAT3 Activation (A) qRT-PCR analysis of the levels of POSTN, c-JUN, RUNX1, RUNX2, STAT3, and YY1 in BM-MSCs and rmCCL2-treated BM-MSCs (n = 3 per group). (B) Western blot analysis of the levels of POSTN, phosphorylated STAT3 (p-STAT3), and STAT3 in BM-MSCs isolated from mice with or without B-ALL. (C) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without RS504393. (D) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without RS504393. (E) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and co-cultured BM-MSCs pre-incubated with or without RS504393. (F) Western blot analysis of the levels of p-STAT3 and STAT3 in mouse BM-MSCs co-cultured with L1210-GFP-Luc-sh-ctrl cells or L1210-GFP-Luc-sh-CCL2 cells. (G) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs transfected with siRNAs to knock down STAT3. (H and I) qRT-PCR assay of the mRNA levels of STAT3 (H) and POSTN (I) in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs (n = 3 per group). (J) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs. (K) Analysis of the effect of STAT3 knockdown in BM-MSCs on CCL2-promoted adhesion of L1210-GFP-Luc cells to mouse BM-MSCs (n = 6 per group). The graphs show mean ± SD. Significance is indicated as follows: **p < 0.01; ***p < 0.001; ns, no significance.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-POSTN Adipogen Cat# AG-20B-0033 Rabbit monoclonal anti-GFP Abcam Cat# ab183734 Mouse monoclonal anti-MCP-1 Cell Signaling Technology Cat# 2029 Rabbit monoclonal anti-Intergrin Linked ILK Abcam Cat# ab52480 Rabbit monoclonal anti-Phospho-NF-kB p65 Cell Signaling Technology Cat# 3033T Rabbit monoclonal anti-NF-kB p65 Cell Signaling Technology Cat# 8242 Rabbit monoclonal anti-Phospho-STAT3 Cell Signaling Technology Cat# 9145 Mouse monoclonal anti-STAT3 Cell Signaling Technology Cat# 9132 Rabbit monoclonal anti-AKT Cell Signaling Technology Cat# 9272 Rabbit monoclonal anti-Phospho-FAK Cell Signaling Technology Cat# 3281 Mouse monoclonal anti-Phospho-JNK Cell Signaling Technology Cat# 9255 Rabbit monoclonal anti-JNK Cell Signaling Technology Cat# 9252 Rabbit monoclonal anti-Phospho-AKT Cell Signaling Technology Cat# 9271 Anti-Integrin aVb3 antibody Millipore/Merck Cat# MAB1876-Z Anti-Integrin aVb5 antibody Millipore/Merck Cat# MAB1961 Rabbit monoclonal anti-Ki67 Abcam Cat# ab15580 Rabbit monoclonal anti-ERK Cell Signaling Technology Cat# 4695 Rabbit monoclonal anti-Phospho-ERK Cell Signaling Technology Cat# 3211 Mouse monoclonal anti-FAK BD Biosciences Cat# 610087 Rabbit monoclonal anti-b-actin ABclonal Cat# AC026 Goat anti-Rabbit IgG (H+L) Secondary Antibody, HRP Thermo Fisher Scientific Cat# 31460 Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP Thermo Fisher Scientific Cat# 31430 Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 546 Thermo Fisher Scientific Cat# A10040 Biological Samples Human bone marrow tissue samples The First Affiliated Hospital of Hunan Normal University N/A Human serum samples The First Affiliated Hospital of Hunan Normal University N/A Chemicals, Peptides, and Recombinant Proteins CCR2 Chemokine receptor anagonist RS504393 TOCRIS Cat# 2517 ILK inhibitor Cpd 22 Millipore/Merck Cat# 407331 BAY11-7082 MedChemExpress Cat# HY-13453 PD98059 MedChemExpress Cat# HY-12028 Human Periostin/OSF-2 DuoSet ELISA R&D Cat# DY3548B Human CCL2/MCP-1 DuoSet ELISA R&D Cat# DY279 Recombinant Human Periostin/OSF-2 Protein, CF R&D Cat# 3548-F2 Recombinant Mouse Periostin/OSF-2 Protein, CF R&D Cat# 2955-F2 Recombinant Mouse CCL2/JE/MCP-1 Protein R&D Cat# 479-JE-050 (Continued on next page) e1 Cell Reports 26, 1533–1543.e1–e4, February 5, 2019

    Techniques: Expressing, Activation Assay, Quantitative RT-PCR, Western Blot, Isolation, Incubation, Cell Culture, Transfection, Knockdown

    Figure 6. CCL2 Promotes the Expression of POSTN in BM-MSCs via STAT3 Activation (A) qRT-PCR analysis of the levels of POSTN, c-JUN, RUNX1, RUNX2, STAT3, and YY1 in BM-MSCs and rmCCL2-treated BM-MSCs (n = 3 per group). (B) Western blot analysis of the levels of POSTN, phosphorylated STAT3 (p-STAT3), and STAT3 in BM-MSCs isolated from mice with or without B-ALL. (C) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without RS504393. (D) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without RS504393. (E) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and co-cultured BM-MSCs pre-incubated with or without RS504393. (F) Western blot analysis of the levels of p-STAT3 and STAT3 in mouse BM-MSCs co-cultured with L1210-GFP-Luc-sh-ctrl cells or L1210-GFP-Luc-sh-CCL2 cells. (G) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs transfected with siRNAs to knock down STAT3. (H and I) qRT-PCR assay of the mRNA levels of STAT3 (H) and POSTN (I) in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs (n = 3 per group). (J) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs. (K) Analysis of the effect of STAT3 knockdown in BM-MSCs on CCL2-promoted adhesion of L1210-GFP-Luc cells to mouse BM-MSCs (n = 6 per group). The graphs show mean ± SD. Significance is indicated as follows: **p < 0.01; ***p < 0.001; ns, no significance.

    Journal: Cell reports

    Article Title: Bone Marrow Mesenchymal Stromal Cell-Derived Periostin Promotes B-ALL Progression by Modulating CCL2 in Leukemia Cells.

    doi: 10.1016/j.celrep.2019.01.034

    Figure Lengend Snippet: Figure 6. CCL2 Promotes the Expression of POSTN in BM-MSCs via STAT3 Activation (A) qRT-PCR analysis of the levels of POSTN, c-JUN, RUNX1, RUNX2, STAT3, and YY1 in BM-MSCs and rmCCL2-treated BM-MSCs (n = 3 per group). (B) Western blot analysis of the levels of POSTN, phosphorylated STAT3 (p-STAT3), and STAT3 in BM-MSCs isolated from mice with or without B-ALL. (C) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without RS504393. (D) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs and rmCCL2-treated BM-MSCs pre-incubated with or without RS504393. (E) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in BM-MSCs and co-cultured BM-MSCs pre-incubated with or without RS504393. (F) Western blot analysis of the levels of p-STAT3 and STAT3 in mouse BM-MSCs co-cultured with L1210-GFP-Luc-sh-ctrl cells or L1210-GFP-Luc-sh-CCL2 cells. (G) Western blot analysis of the levels of p-STAT3 and STAT3 in BM-MSCs transfected with siRNAs to knock down STAT3. (H and I) qRT-PCR assay of the mRNA levels of STAT3 (H) and POSTN (I) in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs (n = 3 per group). (J) Western blot analysis of the levels of POSTN, p-STAT3, and STAT3 in mouse BM-MSCs and rmCCL2-treated and siRNA-transfected BM-MSCs. (K) Analysis of the effect of STAT3 knockdown in BM-MSCs on CCL2-promoted adhesion of L1210-GFP-Luc cells to mouse BM-MSCs (n = 6 per group). The graphs show mean ± SD. Significance is indicated as follows: **p < 0.01; ***p < 0.001; ns, no significance.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-POSTN Adipogen Cat# AG-20B-0033 Rabbit monoclonal anti-GFP Abcam Cat# ab183734 Mouse monoclonal anti-MCP-1 Cell Signaling Technology Cat# 2029 Rabbit monoclonal anti-Intergrin Linked ILK Abcam Cat# ab52480 Rabbit monoclonal anti-Phospho-NF-kB p65 Cell Signaling Technology Cat# 3033T Rabbit monoclonal anti-NF-kB p65 Cell Signaling Technology Cat# 8242 Rabbit monoclonal anti-Phospho-STAT3 Cell Signaling Technology Cat# 9145 Mouse monoclonal anti-STAT3 Cell Signaling Technology Cat# 9132 Rabbit monoclonal anti-AKT Cell Signaling Technology Cat# 9272 Rabbit monoclonal anti-Phospho-FAK Cell Signaling Technology Cat# 3281 Mouse monoclonal anti-Phospho-JNK Cell Signaling Technology Cat# 9255 Rabbit monoclonal anti-JNK Cell Signaling Technology Cat# 9252 Rabbit monoclonal anti-Phospho-AKT Cell Signaling Technology Cat# 9271 Anti-Integrin aVb3 antibody Millipore/Merck Cat# MAB1876-Z Anti-Integrin aVb5 antibody Millipore/Merck Cat# MAB1961 Rabbit monoclonal anti-Ki67 Abcam Cat# ab15580 Rabbit monoclonal anti-ERK Cell Signaling Technology Cat# 4695 Rabbit monoclonal anti-Phospho-ERK Cell Signaling Technology Cat# 3211 Mouse monoclonal anti-FAK BD Biosciences Cat# 610087 Rabbit monoclonal anti-b-actin ABclonal Cat# AC026 Goat anti-Rabbit IgG (H+L) Secondary Antibody, HRP Thermo Fisher Scientific Cat# 31460 Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP Thermo Fisher Scientific Cat# 31430 Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 546 Thermo Fisher Scientific Cat# A10040 Biological Samples Human bone marrow tissue samples The First Affiliated Hospital of Hunan Normal University N/A Human serum samples The First Affiliated Hospital of Hunan Normal University N/A Chemicals, Peptides, and Recombinant Proteins CCR2 Chemokine receptor anagonist RS504393 TOCRIS Cat# 2517 ILK inhibitor Cpd 22 Millipore/Merck Cat# 407331 BAY11-7082 MedChemExpress Cat# HY-13453 PD98059 MedChemExpress Cat# HY-12028 Human Periostin/OSF-2 DuoSet ELISA R&D Cat# DY3548B Human CCL2/MCP-1 DuoSet ELISA R&D Cat# DY279 Recombinant Human Periostin/OSF-2 Protein, CF R&D Cat# 3548-F2 Recombinant Mouse Periostin/OSF-2 Protein, CF R&D Cat# 2955-F2 Recombinant Mouse CCL2/JE/MCP-1 Protein R&D Cat# 479-JE-050 (Continued on next page) e1 Cell Reports 26, 1533–1543.e1–e4, February 5, 2019

    Techniques: Expressing, Activation Assay, Quantitative RT-PCR, Western Blot, Isolation, Incubation, Cell Culture, Transfection, Knockdown